circad | circRNAs associated with diseases

CircRNA_0002138
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Colorectal Cancer	ICD-10	#N/A (C19)
DBLink	Link to database	PMID	30841415
Experimental Method
Sample Type	Tissue and cell lines	Comparison	35 paired CRC tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGACACTCTGTGCTTTATGGC Reverse CCATTCACATACCTTCCACA	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Ruan, H, Deng, X, Dong, L, Yang, D, Xu, Y, Peng, H, Guan, M (2019). Circular RNA circ_0002138 is down-regulated and suppresses cell proliferation in colorectal cancer. Biomed. Pharmacother., 111:1022-1028.